Orthopedics

The articles prior to January 2013 are part of the back file collection and are not available with a current paid subscription. To access the article, you may purchase it or purchase the complete back file collection here

Feature Article 

Age-related Biological Characterization of Mesenchymal Progenitor Cells in Human Articular Cartilage

Hong-Xing Chang, MD; Liu Yang, MD, PhD; Zhong Li, MD, PhD; Guangxing Chen, MD, PhD; Gang Dai, MD, PhD

Abstract

Adult articular cartilage has a low regeneration capacity due to lack of viable progenitor cells caused by limited blood supply to cartilage. However, recent studies have demonstrated the existence of chondroprogenitor cells in articular cartilage. A critical question is whether these mesenchymal progenitor cells are functionally viable for tissue renewal and cartilage repair to postpone cartilage degeneration.

This study was designed to compare the number and function of mesenchymal progenitor cells in articular cartilage collected from human fetuses, healthy adults (aged 28–45 years), and elderly adults (aged 60–75 years) and cultured in vitro. We detected multipotent mesenchymal progenitor cells, defined as CD105+/CD166+ cells, in human articular cartilage of all ages. However, mesenchymal progenitor cells accounted for 94.69%±2.31%, 4.85%±2.62%, and 6.33%±3.05% of cells in articular cartilage obtained from fetuses, adults, and elderly patients, respectively (P<.001). Furthermore, fetal mesenchymal progenitor cells had the highest rates of proliferation measured by cell doubling times and chondrogenic differentiation as compared to those from adult and elderly patients. In contrast, alkaline phosphatase levels, which are indicative of osteogenic differentiation, did not show significant reduction with aging. However, spontaneous osteogenic differentiation was detected only in mesenchymal progenitor cells from elderly patients (with lower Markin scales). The lower chondrogenic and spontaneous osteogenic differentiation of mesenchymal progenitor cells derived from elderly patients may be associated with the development of primary osteoarthritis. These results suggest that measuring cartilage mesenchymal progenitor cells may not only identify underlying mechanisms but also offer new diagnostic and therapeutic potential for patients with osteoarthritis.

Abstract

Adult articular cartilage has a low regeneration capacity due to lack of viable progenitor cells caused by limited blood supply to cartilage. However, recent studies have demonstrated the existence of chondroprogenitor cells in articular cartilage. A critical question is whether these mesenchymal progenitor cells are functionally viable for tissue renewal and cartilage repair to postpone cartilage degeneration.

This study was designed to compare the number and function of mesenchymal progenitor cells in articular cartilage collected from human fetuses, healthy adults (aged 28–45 years), and elderly adults (aged 60–75 years) and cultured in vitro. We detected multipotent mesenchymal progenitor cells, defined as CD105+/CD166+ cells, in human articular cartilage of all ages. However, mesenchymal progenitor cells accounted for 94.69%±2.31%, 4.85%±2.62%, and 6.33%±3.05% of cells in articular cartilage obtained from fetuses, adults, and elderly patients, respectively (P<.001). Furthermore, fetal mesenchymal progenitor cells had the highest rates of proliferation measured by cell doubling times and chondrogenic differentiation as compared to those from adult and elderly patients. In contrast, alkaline phosphatase levels, which are indicative of osteogenic differentiation, did not show significant reduction with aging. However, spontaneous osteogenic differentiation was detected only in mesenchymal progenitor cells from elderly patients (with lower Markin scales). The lower chondrogenic and spontaneous osteogenic differentiation of mesenchymal progenitor cells derived from elderly patients may be associated with the development of primary osteoarthritis. These results suggest that measuring cartilage mesenchymal progenitor cells may not only identify underlying mechanisms but also offer new diagnostic and therapeutic potential for patients with osteoarthritis.

Drs Chang, Yang, Li, Chen, and Dai are from the Department of Joint Surgery, Southwest Hospital, Third Military Medical University, Chongqing, and Dr Chang is also from the Department of Orthopedics, Beijing Army General Hospital of PLA, Beijing, China.

Drs Chang, Yang, Li, Chen, and Dai have no relevant financial relationships to disclose. This study was supported by The National Natural Science Foundation of China (no. 30901576 and 30672200).

Correspondence should be addressed to: Gang Dai, MD, PhD, Department of Joint Surgery, Southwest Hospital, The Third Military Medical University, Chongqing 400038, China (daigang60@163.com).

Posted Online: August 08, 2011

Osteoarthritis results from an imbalance between damage to and repair of articular cartilage. Chondrocytes are thought to be terminal cells with limited capacity for proliferation, primarily because of poor blood circulation and a limited number of available stem cells.1 The articular cartilage is, therefore, often considered to be at high risk for age-related diseases.2,3 However, several recent studies have determined that chondrocytes from healthy primary osteoarthritis patients express markers specific for stem cells.4,5 These cells are called mesenchymal progenitor cells. Why, then, can’t the existing mesenchymal progenitor cells prevent or postpone cartilage degeneration? Previous studies have shown that aging stem cells from the bone marrow reduce the rate of generation and have a lower capacity of proliferation and differentiation.6,7 However, no report exists on the correlation between age and the rate of proliferation of cartilage mesenchymal progenitor cells.

We hypothesized that the ability of cartilage mesenchymal progenitor cells to proliferate and differentiate declines with age, leading to age-related decrease in chondrocyte numbers and function. This age-related decline in chondrocyte number and function directly contributes to the development of primary osteoarthritis. This study compared the in vitro functions of mesenchymal progenitor cells, defined as CD166+/CD105+ cells, isolated from cartilage and surgically removed from patients of different ages. The results may offer new insights into the pathogenesis of osteoarthritis and lead to the development of new preventive and therapeutic agents to improve the quality of life for patients with osteoarthritis.

Materials and Methods

Collection of Articular Cartilage

Fetal cartilage samples were obtained from fetuses aged 20 to 24 weeks who had died of congenital heart abnormalities. Samples of knee joint cartilage were taken from adult and elderly patients who had either died of other diseases or had undergone limb amputation. All cartilage was without visible joint disease (Table 1). Articular cartilage was dissected from the femoral condyle with perichondrium and subchondral bone excised and washed 3 times with phosphate buffered saline to remove blood and soft tissue on the surface. All samples were graded according to a modified Mankin scale (0–2).8 Despite our efforts in choosing cartilage with minimal evidence of degeneration, cells collected for the study may have had age-associated degenerative changes in cartilage, which may have impacted the study. Samples were obtained after an informed consent form was signed by the patients and/or guardians. The study was approved by the hospital ethics committee.

Cartilage Resource and Modified Mankin Scale8

Table 1: Cartilage Resource and Modified Mankin Scale8

Culture of Cartilage Cells

Articular cartilage cells were isolated as previously described.9 Briefly, an articular cartilage was cut into 1-mm3 pieces and incubated with phosphate buffered saline containing 0.1% trypsin, 0.1% hyaluronidase, and 0.2% type II collagenase at 37°C for 1 hour and 3 hours, respectively. Chondrocytes were harvested by centrifugation at 1000 rpm for 5 minutes and seeded into a cell culture flask at a plating density of 3×104 cells/cm2 in Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F-12) medium with 10% fetal bovine serum, 100 IU/mL penicillin, and 100 μg/mL streptomycin. The cell culture was maintained at 37°C with air that contained 5% (v/v) CO2. The medium was changed 72 hours after initial seeding, and chondrocytes continued to be cultured until 80% confluent. Cells were then detached with trypsin (0.25%) and reseeded at control densities for functional assays.

Detection of CD105+/CD166+ Cells in Chondrocytes From Articular Cartilage

Cells from the primary culture and after the second and fourth passages were detached with trypsin and resuspended to a final concentration of 105 cells/50 μl in phosphate buffered saline supplemented with 1% bovine serum albumin and incubated with phycoerythrin-conjugated anti-CD105 (monoclonal antibody SN6) and fluorescein isothiocyanate (FITC)-conjugated anti-CD166 antibodies for 45 minutes at 4°C. Cells stained with a mouse isotype IgG were used as negative control. After antibody binding, cells were washed 3 times with phosphate buffered saline containing 1% bovine serum albumin to remove unbound antibodies and fixed in 4% paraformaldehyde in phosphate buffered saline for 15 minutes at room temperature. They were subjected to fluorescence-activated cell sorting using a FACScan and analyzed with the CellQuest program (Becton Dickinson, San Jose, California).

For flow cytometry analysis, cells were first gated on the forward and side scatters to exclude debris and cell aggregates and then detected for specific antibody binding. The percentage of dual-positive cells was calculated after subtracting non-specific binding of mouse isotype IgG as described previously.4

Isolation of Articular Cartilage Mesenchymal Progenitor Cells

An Anti-FITC MultiSort Kit and a miniMACS separation system were used to purify mesenchymal progenitor cells according to instructions from the manufacturer (Miltenyi Biotec, Bergisch Gladbach, Germany). Briefly, chondrocytes from the fourth passage in culture were harvested and suspended in phosphate buffered saline. They were incubated with an FITC-CD166 antibody (1:50 dilution) for 45 minutes in the dark at 4°C. The stained cells were washed twice and then resuspended in 80 μl of 1× phosphate buffered saline containing 1% bovine serum albumin and 0.1% NaN3. They were then incubated with 10 μl of an anti-FITC antibody coupled to magnetic beads for 30 minutes at 4°C. After washing, CD166+ cells were selected with a magnetic apparatus (Miltenyi Biotec). The selected CD166+ cells were further selected with CD105 micromagnetic beads (Miltenyi Biotec) to eventually obtain cells that are positive for CD166 and CD105. The sorted cells were cultured at a density of 5×104 cells/cm2.

Laser Scanning Confocal Fluorescence Microscopy

Magnetic bead-purified mesenchymal progenitor cells were either prepared as smears for histological examination or seeded on a 10×10-mm cover glass to be cultured in DMEM/F-12 culture medium for 3 days. Cells prepared in both techniques were fixed in 4% polyoxymethylene (30 minutes at room temperature). The fixed cells were first blocked with a buffer containing 5% fetal bovine serum and 2% bovine serum albumin for 30 minutes and then stained for phycoerythrin-conjugated CD105 (1:50 dilution) and FITC-conjugated CD166 (1:50 dilution) antibodies (phycoerythrin or FITC mouse IgG as controls) for 30 to 45 minutes at room temperature. The slides were counterstained with 4,6-diamidino-2-phenylindole (DAPI) to mark the nucleus. Fluorescently labeled cells were visualized and imaged under a confocal laser scanning microscope (Leica TCS SP5; Leica Microsystems, Wetzlar, Germany).

Cell Doubling Time

Cell doubling time (Td) was used to calculate the ability to proliferate. Mesenchymal progenitor cells in culture (second passage) were detached with trypsin (0.25%), suspended in DMEM/F-12 medium containing 10% fetal bovine serum, and plated into a 96-well plate (2×103 cells/well). Cells in 3 wells from each age group were processed in a standard MTT procedure10 and examined every 24 hours (optical density, 570 nm). A growth curve was plotted from these optical density values to calculate mesenchymal progenitor cells-cell doubling time in each age group based on the following formula: Td=t*lg2/(lgNt-lgN0), where t is time in culture (hours), N0 is the seeding density of cells, and Nt is the cell density after t hours in culture.

Detection of Articular Cartilage Mesenchymal Progenitor Cells Differentiation

Chondrogenic Induction. Mesenchymal progenitor cells were cultured with chondrogenic medium (DMEM/F-12 supplemented with 1% ITS Liquid Media Supplement (Sigma-Aldrich Co, St Louis, Missouri), 1 mM sodium pyruvate, 37.5 g/mL ascorbate 2-phosphate, 10-8 M dexamethasone, and 10 ng/mL recombinant human transforming growth factor-β1) for 2 weeks.4 Control cells were cultured in DMEM/F-12 containing 10% fetal bovine serum.

After 2 weeks in culture, total RNA was isolated using TRIzol reagent (Tiangen Biotech Co Ltd, Beijing, China) and used for semiquantitative reverse transcription-polymerase chain reaction to detect the expression of type II collagen and aggrecan gene. Reverse transcription was first performed with 1 μg of total RNA from each sample using oligo(dT)18 primer and 200 units of SuperScript II RT (Life Technologies Inc, Gaithersburg, Maryland) for cDNA synthesis. DNA (in triplicate) was then amplified in 20 μL solution that contained 2 μl diluted template, 10 pmol primer pairs for type II collagen, and aggrecan and control glyceraldehyde 3-phosphate dehydrogenase (Table 2), respectively, and 10 μl Taq PCR Master Mix (TianGen Biotech Co Ltd). The amplification was induced first at 94°C for 5 minutes, followed by 30 cycles of 30 seconds at 94°C, 30 seconds at 57°C, and 30 seconds at 72°C. The reaction was completed by a final incubation at 72°C for 10 minutes. Gene expression was expressed as 2-ΔΔ(Ct), where Ct is the cycle threshold, Δ(Ct) is the Ct of the tested gene–Ct of glyceraldehyde 3-phosphate dehydrogenase, and ΔΔ(Ct) is the Δ(Ct) of sample 1–Δ(Ct) of sample 2.11

Primers Used for Real-time Polymerase Chain Reaction

Table 2: Primers Used for Real-time Polymerase Chain Reaction

Osteogenic Induction. Mesenchymal progenitor cells (1×104/cm2) were first cultured in DMEM/F-12 medium for 24 hours and then switched to the osteogenic medium (50 μmol/L ascorbic acid, 10 μM β-sodium glycerophosphate, and 0.1 μM dexamethasone)12 for 14 days. Control cells were cultured in DMEM/F-12 containing 10% fetal bovine serum. Intracellular alkaline phosphatase was measured with a commercial kit (LabAssay; Wako Pure Chemical Industries, Ltd, Osaka, Japan) at 405 nm and calculated as instructed by the manufacturer.

Statistical Analysis

All values are presented as mean±standard error of mean from repeated experiments. The quantitative data were analyzed using SPSS 13.0 software (SPSS, Inc, Chicago, Illinois). The Kruskal-Wallis test (non-parametric) was used to compare among multiple groups. The independent samples t test was used to assess difference between 2 groups of variables. A P value <.05 was considered statistically significant.

Results

CD105+/CD166+ Cells in Articular Cartilage

The percentage distributions of CD105+/CD166+, CD34+, and CD45+ cells purified from articular cartilage were similar to mesenchymal progenitor cells from the bone marrow (Figure 1), consistent with a previous report on mesenchymal progenitor cells.4 In primary culture, articular cartilage from fetuses had the highest percentage of CD166+/CD105+ cells as compared to those from adult and elderly patients (P<.001). There was no statistical difference in the counts of CD166+/CD105+ cells between articular cartilage obtained from adult and elderly patients. However, the percent of CD166+/CD105+ cells from adult and elderly patients significantly increased in culture, whereas those from fetal tissue (which counted for >90%) did not show significant changes (Table 3; Figure 2).

CD166-fluorescein isothiocyanate/CD105-phycoerythrin positive cells after immunomagnetic purification was identified by fluorescence-activated cell analysis (A). The same technology was also used to detect positivity for CD34 (0.50%) and CD45 (0.69%) (B). Laser scanning confocal fluorescence microscope detected mesenchymal progenitor cells after labeling with phycoerythrin-CD105 and fluorescein isothiocyanate-CD166 antibodies. DAPI (4′,6-diamidino-2-phenylindole) was used to highlight the nucleus. Geometrical mean fluorescence was used to measure the antibody binding in fluorescence intently (X axis). Representative of 5 independent experiments (C).

Figure 1: CD166-fluorescein isothiocyanate/CD105-phycoerythrin positive cells after immunomagnetic purification was identified by fluorescence-activated cell analysis (A). The same technology was also used to detect positivity for CD34 (0.50%) and CD45 (0.69%) (B). Laser scanning confocal fluorescence microscope detected mesenchymal progenitor cells after labeling with phycoerythrin-CD105 and fluorescein isothiocyanate-CD166 antibodies. DAPI (4′,6-diamidino-2-phenylindole) was used to highlight the nucleus. Geometrical mean fluorescence was used to measure the antibody binding in fluorescence intently (X axis). Representative of 5 independent experiments (C).

CD105+/CD166+ Mesenchymal Progenitor Cells in Articular Cartilage in Different Age Groups

Table 3: CD105+/CD166+ Mesenchymal Progenitor Cells in Articular Cartilage in Different Age Groups

Fluorescence-activated cell-sorting analysis of chondrocytes was presented on forward/side scatter plot for primary culture (A) and after 4 passages (B). The scatter plot was set on a linear scale to indicate particle size and was used to exclude cellular debris and aggregates. The CD166-fluorescein isothiocyanate/CD105-phycoerythrin staining was detected in the primary culture (C) and after 4 passages (D) in geometrical mean fluorescence.

Figure 2: Fluorescence-activated cell-sorting analysis of chondrocytes was presented on forward/side scatter plot for primary culture (A) and after 4 passages (B). The scatter plot was set on a linear scale to indicate particle size and was used to exclude cellular debris and aggregates. The CD166-fluorescein isothiocyanate/CD105-phycoerythrin staining was detected in the primary culture (C) and after 4 passages (D) in geometrical mean fluorescence.

Growth and Proliferation of Mesenchymal Progenitor Cells

The mesenchymal progenitor cells from fetal articular cartilage were short, spindle-shaped cells that grew rapidly, whereas most of the mesenchymal progenitor cells from articular cartilage of adult and elderly patients were longer spindle-shaped cells (Figure 3). The proliferation capacity was lower for mesenchymal progenitor cells from adult and elderly patients as compared to those from fetal samples, with the cell doubling times of 25.68±7.71 hours, 45.35±15.41 hours, and 55.69±16.52 hours for fetal-, adult-, and elderly-derived mesenchymal progenitor cells, respectively (Figure 4).

Morphological characterization of chondrocytes (A–C) and CD166+/CD105+ mesenchymal progenitor cells (D–F) from fetal, adult, and elderly patients, respectively, after 2 passages in culture.

Figure 3: Morphological characterization of chondrocytes (A–C) and CD166+/CD105+ mesenchymal progenitor cells (D–F) from fetal, adult, and elderly patients, respectively, after 2 passages in culture.

Cell growth (1 passage in culture) was measured for mesenchymal progenitor cells from different age groups, indicating a higher grown rate for fetal mesenchymal progenitor cells (A). Cell doubling time was calculated for mesenchymal progenitor cells from different groups of patients, showing a lowest double time (Kruskal-Wallis test, P=.001) (B).

Figure 4: Cell growth (1 passage in culture) was measured for mesenchymal progenitor cells from different age groups, indicating a higher grown rate for fetal mesenchymal progenitor cells (A). Cell doubling time was calculated for mesenchymal progenitor cells from different groups of patients, showing a lowest double time (Kruskal-Wallis test, P=.001) (B).

Chondrogenic Differentiation

mRNA for aggrecan and type II collagen were the highest in chondrogenic-induced fetal mesenchymal progenitor cells as compared to those from adult and elderly patients (P<.05) (Figure 5). These results indicate that CD105+/CD166+ mesenchymal progenitor cells in the resting state differentiated into chondrocytes and upregulated the expression of aggrecan and type II collagen mRNA in the presence of growth factors.

mRNA for aggrecan and type II collagen was detected by real-time polymerase chain reaction with the unit of Y-axis as the relative expression level measured in quantitative polymerase chain reaction. The expression levels of aggrecan and type II collagen mRNA in fetal (group A), adult (group B), and elderly (group C) mesenchymal progenitor cells were 7.79 and 9.34 times the control, 5.82 and 7.02 times the control, and 2.24 and 2.93 times the control, respectively. The chondrogenic potential declines with age (P<.01), and chondrogenic differentiation was also significantly reduced in aged cartilages.

Figure 5: mRNA for aggrecan and type II collagen was detected by real-time polymerase chain reaction with the unit of Y-axis as the relative expression level measured in quantitative polymerase chain reaction. The expression levels of aggrecan and type II collagen mRNA in fetal (group A), adult (group B), and elderly (group C) mesenchymal progenitor cells were 7.79 and 9.34 times the control, 5.82 and 7.02 times the control, and 2.24 and 2.93 times the control, respectively. The chondrogenic potential declines with age (P<.01), and chondrogenic differentiation was also significantly reduced in aged cartilages.

Osteogenic Differentiation

Levels of alkaline phosphatase in mesenchymal progenitor cells from all age groups increased after osteogenic induction, indicating that cartilage mesenchymal progenitor cells from all ages maintained a normal osteogenic differentiation capacity. However, a 2-week induction resulted in a higher level of alkaline phosphatase in mesenchymal progenitor cells from adult patients as compared to those from fetal and elderly patients, but the difference did not reach statistical significance (Figure 6). Without induction, alkaline phosphatase of mesenchymal progenitor cells from elderly patients was significantly higher than that of the other 2 groups (P=.007), suggesting that mesenchymal progenitor cells from elderly patients’ cartilage might have undergone spontaneous osteogenic differentiation.

The alkaline phosphatase (ALP) levels after osteogenic induction of mesenchymal progenitor cells show no significant difference among the 3 groups (P=.215), but show a significant difference among different patients without induction (controls).

Figure 6: The alkaline phosphatase (ALP) levels after osteogenic induction of mesenchymal progenitor cells show no significant difference among the 3 groups (P=.215), but show a significant difference among different patients without induction (controls).

Discussion

Chondrocytes are thought to be terminal cells with low capacity for reproduction or self-renewal. Blood circulation in articular cartilage is also poor, potentially resulting in limited supply of progenitor cells critical for tissue renewal.2,3 These factors contribute in part to a high risk for age-related disease in articular cartilage. However, recent studies have found that osteoarthritis chondrocyte express stem cell markers.4,5 A key question is whether these mesenchymal progenitor cells undergo functional changes that result in progressively reduced capacity for self-renewal and differentiation. We have provided experimental evidence that human cartilage of all ages contained CD105+/CD166+ mesenchymal progenitor cells,13,14 which are known to differentiate into mature cells of chondrogenic as well as adipogenic and osteogenic lineages.4,15 As expected, mesenchymal progenitor cells were found to have a higher quantity in fetal cartilage, consistent with a previous report.4 Interestingly, mesenchymal progenitor cells in cartilage from elderly patients were similar in quantity to those from adult patients, indicating a minimal decline in mesenchymal progenitor cells between the 2 age groups.

Despite their universal presence, we found that fetal mesenchymal progenitor cells had a higher rate of proliferation and chondrogenic capacity as compared to aged cartilage (Figures 4, 5), similar to those found in bone marrow mesenchymal progenitor cells.6,16 This low rate of proliferation and slow induction is consistent with finding that aged cartilage had a lower percentage of mesenchymal progenitor cells that had a reduced chondrogenic capacity, as shown in Figure 5. A role of aging in mesenchymal stem cell differentiation has been debated.7,17 Our observations strongly suggest a mechanism that supports for age-related development of cartilage degeneration and osteoarthritis.

Furthermore, spontaneous osteogenic differentiation in mesenchymal progenitor cells derived from elderly patients may be related to primary osteoarthritis. For example, mesenchymal progenitor cells cultured in a transforming growth factor-β-containing chondrogenic medium display signs consistent with chondrocyte hypertrophy.18 Osteoarthritis chondrocytes in culture show significant hypertrophy after transforming growth factor-β induction,19 which precedes cartilage apoptosis, vessel invasion, and calcification during cartilage development. Xiao et al20 compared the gene-expression pattern in the bone marrow-mesenchymal stem cells of geriatric (>2 years), osteoporotic and nonosteoporotic adult (7 months), and juvenile (7 weeks) rats and detected the highest high expression of osteoblast-related genes in geriatric rats. Together, these findings imply that mesenchymal progenitor cells from elderly animals could promote the development of osteoarthritis by differentiating into bone cells.

Although we have observed significant differences in mesenchymal progenitor cell function in patients from different age groups, the sample size for this study is too small to establish a linear relationship between age and mesenchymal progenitor cell functionalities, due to difficulties obtaining cartilage tissue. It may be more informative to study cartilage mesenchymal progenitor cells at epiphyses fusion age, when cartilage evolves from the growth phase to the stationary phase. This concern is partially addressed by examining fetal cartilage, which represents the growth phase, as well as adult and elderly cartilage, which represent the stationary and degenerative phases. Nevertheless, more studies on the subject are called for, including larger randomized controlled trials to study how mesenchymal progenitor cells associate with osteoarthritis development and to explore the potential of using mesenchymal progenitor cells as a therapeutic alternative to the standard care of patients with osteoarthritis.

References

  1. Poole AR. Cartilage in health and disease. In: Koopman WJ, Moreland LW, eds. Arthritis and Allied Conditions: A Textbook of Rheumatology. 15th ed. Baltimore, MD: Lippincott Williams & Wilkins; 2003:226–284.
  2. Buckwalter JA, Brown TD. Joint injury, repair, and remodeling: roles in post-traumatic osteoarthritis. Clin Orthop Relat Res. 2004; (423):7–16. doi:10.1097/01.blo.0000131638.81519.de [CrossRef]
  3. O’Driscoll S. Update on cartilage repair. Orthopedics. 2002; 25(12):1342,1388.
  4. Alsalameh S, Amin R, Gemba T, Lotz M. Identification of mesenchymal progenitor cells in normal and osteoarthritic human articular cartilage. Arthritis Rheum. 2004; 50(5):1522–1532. doi:10.1002/art.20269 [CrossRef]
  5. Dowthwaite GP, Bishop JC, Redman SN, et al. The surface of articular cartilage contains a progenitor cell population [published online ahead of print February 3, 2004]. J Cell Sci. 2004; 117(Pt 6):889–897. doi:10.1242/jcs.00912 [CrossRef]
  6. D’Ippolito G, Schiller PC, Ricordi C, Roos BA, Howard GA. Age-related osteogenic potential of mesenchymal stromal stem cells from human vertebral bone marrow. J Bone Miner Res. 1999; 14(7):1115–1122. doi:10.1359/jbmr.1999.14.7.1115 [CrossRef]
  7. Murphy JM, Dixon K, Beck S, Fabian D, Feldman A, Barry F. Reduced chondrogenic and adipogenic activity of mesenchymal stem cells from patients with advanced osteoarthritis. Arthritis Rheum. 2002; 46(3):704–713. doi:10.1002/art.10118 [CrossRef]
  8. Mankin HJ, Dorfman H, Lippiello L, Zarins A. Biochemical and metabolic abnormalities in articular cartilage from osteo-arthritic human hips. II. Correlation of morphology with biochemical and metabolic data. J Bone Joint Surg Am. 1971; 53(3):523–537.
  9. Zhou Q, Li QH, Dai G, Shi GH. Efficient isolation of chondrocytes from rabbit articular cartilage with three-step enzymatic digestion and observation of their biological characteristics during cultivation in vitro [in Chinese]. Zhonghua Wai Ke Za Zhi. 2005; 43(8):522–526.
  10. Liu Y, Li YH, Guo FJ, et al. Gamma-aminobutyric acid promotes human hepatocellular carcinoma growth through overexpressed gamma-aminobutyric acid A receptor alpha 3 subunit. World J Gastroenterol. 2008; 14(47):7175–7182. doi:10.3748/wjg.14.7175 [CrossRef]
  11. Pfaffl MW, Horgan GW, Dempfle L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 2002; 30(9):e36. doi:10.1093/nar/30.9.e36 [CrossRef]
  12. Fickert S, Fiedler J, Brenner RE. Identification of subpopulations with characteristics of mesenchymal progenitor cells from human osteoarthritic cartilage using triple staining for cell surface markers [published online ahead of print July 19, 2004]. Arthritis Res Ther. 2004; 6(5):R422–432. doi:10.1186/ar1210 [CrossRef]
  13. Stewart K, Monk P, Walsh S, Jefferiss CM, Letchford J, Beresford JN. STRO-1, HOP-26 (CD63), CD49a and SB-10 (CD166) as markers of primitive human marrow stromal cells and their more differentiated progeny: a comparative investigation in vitro [published online ahead of print July 22, 2003]. Cell Tissue Res. 2003; 313(3):281–290. doi:10.1007/s00441-003-0762-9 [CrossRef]
  14. Kim DH, Yoo KH, Choi KS, et al. Gene expression profile of cytokine and growth factor during differentiation of bone marrow-derived mesenchymal stem cell. Cytokine. 2005; 31(2):119–126. doi:10.1016/j.cyto.2005.04.004 [CrossRef]
  15. Chang HX, Yang L, Li Z, et al. Immunomagnetic sorting and differentiation of mesenchymal stem cells in human articular cartilage. Acta Academiae Medicinae Militaris Tertiae. 2009; 31(21):2041–2045.
  16. Nishida S, Endo N, Yamagiwa H, Tanizawa T, Takahashi HE. Number of osteoprogenitor cells in human bone marrow markedly decreases after skeletal maturation. J Bone Miner Metab. 1999; 17(3):171–177. doi:10.1007/s007740050081 [CrossRef]
  17. Martin JA, Brown TD, Heiner AD, Buckwalter JA, et al. Chondrocyte senescence, joint loading and osteoarthritis. Clin Orthop Relat Res. 2004; (427 Suppl):S96–103. doi:10.1097/01.blo.0000143818.74887.b1 [CrossRef]
  18. Ichinose S, Yamagata K, Sekiya I, Muneta T, Tagami M. Detailed examination of cartilage formation and endochondral ossification using human mesenchymal stem cells. Clin Exp Pharmacol Physiol. 2005; 32(7):561–570. doi:10.1111/j.1440-1681.2005.04231.x [CrossRef]
  19. Yang KG, Saris DB, Geuze RE, et al. Altered in vitro chondrogenic properties of chondrocytes harvested from unaffected cartilage in osteoarthritic joints. Osteoarthritis Cartilage. 2006; 14(6):561–570. doi:10.1016/j.joca.2005.12.002 [CrossRef]
  20. Xiao Y, Fu H, Prasadam I, Yang YC, Hollinger JO. Gene expression profiling of bone marrow stromal cells from juvenile, adult, aged and osteoporotic rats: with an emphasis on osteoporosis [published online ahead of print December 12, 2006]. Bone. 2007; 40(3):700–715. doi:10.1016/j.bone.2006.10.021 [CrossRef]

Cartilage Resource and Modified Mankin Scale8

GroupPatient SexNo. PatientsPatient AgeDiseaseScale
FetalM320.8±1.7 wkCongenital cardiac malformation0
F519–24 wk
AdultM734.9±5.5 yOrgan donor, amputation1–2
F428–45 y
ElderlyM565.8±5.5 yOrgan donors, amputation, autopsy2
F360–75 y

Primers Used for Real-time Polymerase Chain Reaction

SequenceSequence ForwardSequence Reverse
Type II collagen5′ CCTTCCTGCGCCTGCTGTC 3′5′ GGCCCGGATCTCCACGTC 3′
Aggrecan5′ TGGAGGTGGTGGTGAAAGGTGT 3′5′ GGCGTCGCACTGGTGGAA 3′
GAPDH5′ ACCCATCACCATCTTCCAGGAG 3′5′ GAAGGGGCGGAGATGATGAC 3′

CD105+/CD166+ Mesenchymal Progenitor Cells in Articular Cartilage in Different Age Groups

%
PValue
FetalAdultElderly
Primary cells94.69±2.314.85±2.626.33±3.05<.001
P2 cells93.18±3.1111.35±3.8111.96±4.13a<.001
P value.346<.001.008
Authors

Drs Chang, Yang, Li, Chen, and Dai are from the Department of Joint Surgery, Southwest Hospital, Third Military Medical University, Chongqing, and Dr Chang is also from the Department of Orthopedics, Beijing Army General Hospital of PLA, Beijing, China.

Drs Chang, Yang, Li, Chen, and Dai have no relevant financial relationships to disclose. This study was supported by The National Natural Science Foundation of China (no. 30901576 and 30672200).

Correspondence should be addressed to: Gang Dai, MD, PhD, Department of Joint Surgery, Southwest Hospital, The Third Military Medical University, Chongqing 400038, China (daigang60@163.com).

10.3928/01477447-20110627-06

Sign up to receive

Journal E-contents