Orthopedics

The Cutting Edge 

Single Percutaneous Injection of Stromal Cell-Derived Factor-1 Induces Bone Repair in Mouse Closed Tibial Fracture Model

Xin Li, MD; Zhongli Gao, MD; Jincheng Wang, MD, PhD

Abstract

Stromal cell-derived factor-1 is a dominant chemokine in bone marrow that is known to be involved in inflammatory diseases, including rheumatoid arthritis. Its role in bone repair has recently been demonstrated. The purpose of this study was to investigate the role of extraneous stromal cell-derived factor-1 in fracture healing.

Abstract

Stromal cell-derived factor-1 is a dominant chemokine in bone marrow that is known to be involved in inflammatory diseases, including rheumatoid arthritis. Its role in bone repair has recently been demonstrated. The purpose of this study was to investigate the role of extraneous stromal cell-derived factor-1 in fracture healing.

Drs Li, Gao, and Wang are from the Department of Orthopedic Surgery, Jilin University/China-Japan Union Hospital, Jilin Province, China.

Drs Li, Gao, and Wang have no relevant financial relationships to disclose.

The authors thank Cherie Charbonneau from Brown University/Rhode Island Hospital for assistance with this study.

Correspondence should be addressed to: Xin Li, MD, 126 Xian Tai Ave, Department of Orthopedic Surgery, Jilin University/China-Japan Union Hospital, Changchun, Jilin Province, China, 130033 (doctorlixin@gmail.com).

Millions of people fully recover from fractures annually, but 5% to 10% go on to develop a delayed union or nonunion.1 Impaired fracture healing can result in functional disability; therefore, there is an urgent need for a bioactive agent to stimulate bone formation during the treatment of fracture healing.

Stromal derived factor-1 belongs to the chemokine family, was originally isolated from bone marrow stromal cells,2 and is known to be constitutively produced by fibroblasts and marrow endothelial cells.3 It has been shown previously that stromal cell-derived factor-1 and its receptor CXCR4 play an important role in cell migration and embryonic development.4 Stromal cell-derived factor-1 is also a powerful chemoattractant for the localization of CXCR4 positive bone marrow stromal stem cells into bone marrow.3,5

Recently, stromal cell-derived factor-1 has been proven to be induced in the periosteum of injured bone and to promote endochondral bone repair by recruiting mesenchymal stem cells to the site of injury.6 Thus, stromal cell-derived factor-1 has been recognized as a critical regulator of bone cell function. Additionally, the local delivery of stromal cell-derived factor-1 into injured tissue promotes the recruitment of circulating mesenchymal stromal and progenitor cells to lesions in the heart.7,8 However, the involvement of the exogenous stromal cell-derived factor-1 in bone repair has not been elucidated.

In this study, we hypothesized that exogenous stromal cell-derived factor-1 plays an important role in enchondral bone formation during fracture healing. Using a mouse tibia closed fracture model, and analysis methods such as radiography, histological evaluation, and real-time PCR (the target genes information are shown in Table 1), we demonstrated that exogenous stromal cell-derived factor-1 enhanced bone repair. Our results suggest new strategies for the therapeutic use of exogenous stromal cell-derived factor-1 to promote successful bone healing.

Brief Instructions About the Target Genes Analyzed by RT-PCR

Table 1: Brief Instructions About the Target Genes Analyzed by RT-PCR

Materials and Methods

Experimental Animals

Forty 8-week-old male mice (C57BL/6N) were used in the experiments. The mice were used to create fracture models as previously described.9 Briefly, animals were anesthetized by intraperitoneal injection of a Ketamine-Medetomidine cocktail (75+1 mg/kg). The animals were prepared for surgery by shaving and scrubbing of right hind limbs.

A longitudinal short incision was made at the knee, and a 0.5-mm hole was drilled above the tibial tuberosity. A 30G stainless-steel needle (Hengyuan, Shenzhen, China) was introduced into the intramedullary canal of the tibia. A closed transverse middiaphyseal tibia fracture was created by 3-point bending in the right tibia. Immediately after fracture, a carrier (200 μl of fibrin gel) containing 100 μg of stromal cell-derived factor-1α or carrier alone was applied to the fracture site, and the animal was allowed to move freely after recovering from anesthesia. A preoperative injection of cefadroxil (25 mg/kg) was administered subcutaneously to prevent infection. Tramadol (0.03 mg/kg) was given once preoperatively and 2× per day during the first 3 days postoperatively to relieve pain. Fracture repair was monitored by radiography at time points and in the event of internal fixation failure due to pin slippage, bending, or breakage, the 4 affected mice were excluded from subsequent analysis. At the experimental time points of 9, 14, and 21 days, the animals were euthanized using carbon dioxide and specimens were collected for histology and real-time-PCR analysis.

Radiology Evaluation

With radiographs, a nonuniformly composed material can be viewed. By using the physical properties of the radiograph, an image can display clear areas of different density and composition. A heterogeneous beam radiograph can be produced by a radiograph generator and is projected toward the target object. According to the density and composition of the different areas of the object, a proportion of radiographs are absorbed by the object. The radiographs that pass through are then captured behind the object by a detector (film sensitive to radiographs or a digital detector) that gives a 2-dimensional photograph of all the structures superimposed on each other. The fracture healing progress is followed by the use of radiology.

Histological Evaluation

After the mice were sacrificed, samples of the fractured tibias were removed, fixed in 4% formalin, decalcified, dehydrated, embedded in paraffin, cut into 4-μm-thick sections, and stained using Safranin-O/Fast Green. The samples were then evaluated by light microscopy (Eclipse 55i, Nikon Shanghai, China).

RNA Extraction

The RNeasy Fibrous Tissue Mini kit (Qiagen, Shanghai, China) was used to extract RNA from the fracture calluses with 1 modification. After sacrificing the mice, fracture calluses were saved in RNAlater (Qiagen), and stored at −80°C until RNA extraction. The calluses were ground into a fine powder using a mortar and pestle with liquid nitrogen, and extracted according to the instructions provided with the kit.

Real-Time PCR Analysis

Primers were designed using Primer Premier 5.0 software (Premier Biosoft International, Palo Alto, California) as shown in Table 2. To quantify the target genes, mRNA was performed by real-time quantitative reverse transcriptase PCR. One μg total RNA was transcribed into cDNA using iScrip (Bio-Rad, Shanghai, China). Forty ng/μl of the resulting cDNA was used as the template to quantify the relative content of mRNA by RT-PCR using Sso Fast EvaGreen Supermix (Bio-Rad) with the CFX 96 Real Time PCR system (Bio-Rad). To normalize the data, mRNA expression of a housekeeping gene, 18S, was also determined. The cycle threshold values for 18S RNA and that of samples were measured and calculated by Excel (Office 2007, Microsoft, Redmond, Washington). Relative transcript levels were calculated as x=2−Δ ΔCt, in which ΔΔCt = ΔE–ΔC, and ΔE=Ct-exp –Ct18s; ΔC=Ctctl–Ct18s.

Primer Sequences Used for Polymerase Chain Reaction and Amplification

Table 2: Primer Sequences Used for Polymerase Chain Reaction and Amplification

Statistical Analysis

Data were analyzed by the 2-tailed Student t tests in Excel (Office 2007). Significance was defined at the P<.05 level. All means are expressed as ±SEM.

Results

Radiology Image Analysis

In both groups, periosteal callus formation became visible by day 9 after fracture induction (Figure 1). A larger radiolucent area was seen in the periosteal calluses in the nonstromal cell-derived factor-1 injected group relative to the stromal cell-derived factor-1-injected group (Figure 1, arrows), suggesting that exogenous stromal cell-derived factor-1 enhanced bone formation. Formation of osseous bridging over the fracture site was completed by day 21 in both groups, and the size of the bony calluses in each group were almost equivalent (Figure 1). In contrast, the stromal cell-derived factor-1 treated group showed more nonradiopacity.

Radiographs Showing the Course of Fracture Healing in a Stromal Cell-Derived Factor-1-Treated Mouse (A–C) and in an Untreated Mouse (D–F). Fractured Tibias of Stromal Cell-Derived Factor-1-Treated (A) and Untreated (D) Mice on Day 0. There Was a Bridged Fracture Gap on Day 9 Postfracture and More Callus Formation in the Stromal Cell-Derived Factor-1 Treated Mouse (5 Out of 6) (B) than the Untreated Mouse (2 Out of 6) (E). The Stromal Cell-Derived Factor-1 Treated Mouse Has More Bone Formation on Day 21 (C) Compared to the Untreated Mouse (F).

Figure 1: Radiographs Showing the Course of Fracture Healing in a Stromal Cell-Derived Factor-1-Treated Mouse (A–C) and in an Untreated Mouse (D–F). Fractured Tibias of Stromal Cell-Derived Factor-1-Treated (A) and Untreated (D) Mice on Day 0. There Was a Bridged Fracture Gap on Day 9 Postfracture and More Callus Formation in the Stromal Cell-Derived Factor-1 Treated Mouse (5 Out of 6) (B) than the Untreated Mouse (2 Out of 6) (E). The Stromal Cell-Derived Factor-1 Treated Mouse Has More Bone Formation on Day 21 (C) Compared to the Untreated Mouse (F).

mRNA Expressions in Soft Callus

To investigate the mechanism of increased bone formation in the stromal cell-derived factor-1-treated tibia fracture mice, 3 animals from each group were sacrificed on Day 9 postfracture and total RNA was isolated from the soft callus for RT-PCR analysis. The mRNA expression of collagen type II, vascular endothelial growth factor, fibroblast growth factor-1, and runt-related transcription factor 2 were examined by RT-PCR analyses (Figure 2). We found that on day 9, after fracture, the stromal cell-derived factor-1 treated mouse had significantly higher collagen type II mRNA levels (2.1-fold increase) (Figure 2A), vascular endothelial growth factor mRNA levels (3.2-fold increase) (Figure 2B), fibroblast growth factor mRNA levels (4.0-fold increase) (Figure 2C), and runt-related transcription factor 2 mRNA levels (2.1-fold increase) (Figure 2D) compared with untreated mice.

There Was a Significantly Higher mRNA Expression of Angiogenesis Promoting Genes in the Fracture Soft Callus of Stromal Cell-Derived Factor-1 Treated Mice Compared to Untreated Mice on Day 9 Determined by Real-Time Polymerase Chain Reaction Analysis. Data Are Shown as Mean ±SEM of Triplicate Wells, and Representative Data of Independent Experiments Are Shown. Stromal Cell-Derived Factor-1-Treated Mice Had Significantly More Collagen Type 2 mRNA Levels (2.1 Fold, P=.014) (A), Vascular Endothelial Growth Factor mRNA Levels (3.2 Fold, P=.016) (B), Fibroblast Growth Factor mRNA Levels (4.0 Fold, P=.0003) (C), and Runt-Related Transcription Factor 2 mRNA Levels (2.1 Fold, P=.012) (D), Compared to Untreated Mice. *P<.05, **P<.001, n=6.

Figure 2: There Was a Significantly Higher mRNA Expression of Angiogenesis Promoting Genes in the Fracture Soft Callus of Stromal Cell-Derived Factor-1 Treated Mice Compared to Untreated Mice on Day 9 Determined by Real-Time Polymerase Chain Reaction Analysis. Data Are Shown as Mean ±SEM of Triplicate Wells, and Representative Data of Independent Experiments Are Shown. Stromal Cell-Derived Factor-1-Treated Mice Had Significantly More Collagen Type 2 mRNA Levels (2.1 Fold, P=.014) (A), Vascular Endothelial Growth Factor mRNA Levels (3.2 Fold, P=.016) (B), Fibroblast Growth Factor mRNA Levels (4.0 Fold, P=.0003) (C), and Runt-Related Transcription Factor 2 mRNA Levels (2.1 Fold, P=.012) (D), Compared to Untreated Mice. *P<.05, **P<.001, n=6.

Histology Analysis

Histological staining of cartilage with Safranin-O/Fast-green at 14 days postfracture showed that minimal cartilage remained in the stromal cell-derived factor-1 treated specimens (2 of 6) (Figure 3A). However, cartilage remnants were present in many of the nonstromal cell-derived factor-1 treated specimens at this time point (5 of 6) (Figure 3B). Analysis of the fracture callus demonstrated a significantly reduced number of hypertrophic cartilage cells (3.1 fold) in stromal cell-derived factor-1-treated mice compared with the nontreated group (Figure 3C).

Safranin-O/fast-Green Staining of Tibia Fracture Callus from a Stromal Cell-Derived Factor-1-Treated Mouse and an Untreated Mouse at Day 14 Postfracture. In the Stromal Cell-Derived Factor-1-Treated Mouse (2 of 6) (A), Less Cartilage Remnants and Hypertropic Cartilage Was Found Compared to the Untreated Mouse (5 of 6) (B). Hypertrophic Cartilage Cells in the Callus (C), P<.001, n=6. Scale Bar=500 μm.

Figure 3: Safranin-O/fast-Green Staining of Tibia Fracture Callus from a Stromal Cell-Derived Factor-1-Treated Mouse and an Untreated Mouse at Day 14 Postfracture. In the Stromal Cell-Derived Factor-1-Treated Mouse (2 of 6) (A), Less Cartilage Remnants and Hypertropic Cartilage Was Found Compared to the Untreated Mouse (5 of 6) (B). Hypertrophic Cartilage Cells in the Callus (C), P<.001, n=6. Scale Bar=500 μm.

mRNA Expressions in Hard Callus

In the late stage of fracture healing, we investigated osteogenic gene expression levels.3 Animals from each group were sacrificed on Day 21 postfracture and total RNA was isolated from the hard callus for RT-PCR analysis. The mRNA expression of bone sialoprotein, bone morphogenetic protein, alkaline phosphatase, and collagen type X, were examined by RT-PCR analysis (Figure 4). We found that, 21 days after fracture, the stromal cell-derived factor-1-treated mouse had significantly higher bone sialoprotein mRNA levels (4.3 fold increase) (Figure 4A), bone morphogenetic protein mRNA levels (3.2 fold increase) (Figure 4B), alkaline phosphatase mRNA levels (4.4 fold increase) (Figure 4C), and collagen type X mRNA levels (1.8 fold increase) (Figure 4D) compared with the untreated mice. These data suggest that stromal cell-derived factor-1 has the potential to induce mineralization and osteogenesis in the hard callus during fracture healing, and confirmed the finding in the radiographic imaging study, which showed more bone formation in the stromal cell-derived factor-1 treated group.

Significantly Higher mRNA Expression of Osteogenic- and Mineralization-Related Genes in the Fracture Callus of Stromal Cell-Derived Factor-1-Treated Mice Compared with Untreated Mice on Day 21 Determined by Real-Time Polymerase Chain Reaction Analysis. Data Are Means ±SEM. The Stromal Cell-Derived Factor-1-Treated Mouse Had Significantly Higher Bone Sialoprotein Mrna Levels (4.3 Fold, P=.005) (A), Bone Morphogenetic Protein mRNA Levels (3.2 Fold, P=.016) (B), Alkaline Phosphatase mRNA Levels (4.4 Fold, P=.0001) (C), and Collagen Type X mRNA Levels (1.8 Fold, P=.049) (D) Compared to Untreated Mice. *P<.01, n=6.

Figure 4: Significantly Higher mRNA Expression of Osteogenic- and Mineralization-Related Genes in the Fracture Callus of Stromal Cell-Derived Factor-1-Treated Mice Compared with Untreated Mice on Day 21 Determined by Real-Time Polymerase Chain Reaction Analysis. Data Are Means ±SEM. The Stromal Cell-Derived Factor-1-Treated Mouse Had Significantly Higher Bone Sialoprotein Mrna Levels (4.3 Fold, P=.005) (A), Bone Morphogenetic Protein mRNA Levels (3.2 Fold, P=.016) (B), Alkaline Phosphatase mRNA Levels (4.4 Fold, P=.0001) (C), and Collagen Type X mRNA Levels (1.8 Fold, P=.049) (D) Compared to Untreated Mice. *P<.01, n=6.

Discussion

In this study, we demonstrated that a single injection of exogenous stromal cell-derived factor-1 during endochondral bone repair can induce more rapid fracture healing. Fracture healing can occur through 2 distinct processes. If bone segments are stabilized, mesenchymal precursor cells differentiate directly into bone-forming osteoblasts in a process called intramembranous ossification. Alternatively, most fractures possess some level of mechanical instability and heal by the process of endochondral ossification. Bony callus formation is preceded by a cartilaginous template.10 In this study, we used the intramedullary pin, an unstable fixation, to fix the tibia fracture, and because of this, endochondral ossification occurred in the model. Stromal cell-derived factor-1 has previously been shown to be an important factor in bone marrow stromal stem cell function and bone repair.2,7–9 Thus, we hypothesized that exogenous stromal cell-derived factor-1 could have the ability to induce fracture healing.

We used an exogenous stromal cell-derived factor-1-treated mouse tibia fracture model to verify this hypothesis. We compared radiographs during the fracture-healing process and observed enhanced healing progress in the stromal cell-derived factor-1-treated group with more callus formation in the early stage of bone repair, whereas gaps were still detected in the untreated group. This differential increase in callus formation suggests that a single injection of exogenous stromal cell-derived factor-1 may accelerate bone repair.

To determine the reason why there would be more new bone formation in the stromal cell-derived factor-1-treated mice, we next investigated the relative gene expression levels in soft calluses. Collagen type II is known as a matrix component and is secreted by chondrocytes in the early stages of endochondral ossification.11 Runt-related transcription factor 2 is a key transcription factor associated with osteoblast differentiation.12

Fibroblast growth factor-1 is involved in angiogenesis and has the capacity to induce the process of healing. Vascular endothelial growth factor, one of the proangiogenic factors, is essential for callus formation and mineralization in response to bone injury.10,14–16 Our results show that stromal cell-derived factor-1-treated mice had significantly more angiogenesis, osteoblast, and chondrogenic gene expression. We also verified that the stromal cell-derived factor-1 treated mice healed faster than untreated mice in the mid-stage of fracture healing by the histologic findings.

In the late stage of fracture healing, we studied the relative gene expression levels in hard calluses. Alkaline phosphatase and bone sialoprotein are involved in tissue mineralization. Bone morphogenetic protein-7 has been demonstrated to have the ability to induce all of the genetic markers of osteoblast differentiation in many cell types.17 The expression of collagen type X, a marker for hypertrophic chondrocytes during endochondral ossification, occurs later than that of other cartilage specific genes and may play a role in the mineralization of cartilage.18 We observed that stromal cell-derived factor-1-treated mice had more mineralization and osteogenic gene expression compared with nonstromal cell-derived factor-1-treated mice.

These results favor the notion that exogenous stromal cell-derived factor-1 contributes to increased fracture healing. It has been demonstrated that stromal cell-derived factor-1 is an essential molecule for the migration of mesenchymal stem cells to sites of bone repair in vivo.6 Mesenchymal stem cells can differentiate into multiple cell lineages and promote structural and functional repairs in many organs including bones, making mesenchymal stem cells an interesting candidate for cell-based bone regeneration.19 From the results of the present study, it appears that exogenous stromal cell-derived factor-1 has the potential to recruit mesenchymal stem cells to the injury site and promote endochondral bone repair in the same manner as endogenous stromal cell-derived factor-1. More work needs to be done to elucidate the mechanism of cell migration caused by exogenous stromal cell-derived factor-1. The performance of mechanical testing and bone mineral density tests to confirm whether exogenous stromal cell-derived factor-1 can increase callus mechanical strength should be performed in future studies.

This study demonstrates, for the first time, that exogenous stromal cell-derived factor-1 contributes to endochondral bone repair. More investigation needs to be undertaken to reveal the function of exogenous stromal cell-derived factor-1 in endochondral fracture healing, which is likely to open a new era including a minimally-invasive strategy for the clinical therapeutic use of stromal cell-derived factor-1 to achieve faster bone repair.

References

  1. Einhorn T. Enhancement of fracture-healing. J Bone Joint Surg Am. 1995; 77(6):940–956.
  2. Jo DY, Rafii S, Hamada T, et al. Chemotaxis of primitive hematopoietic cells in response to stromal cell-derived factor-1. J Clin Invest. 2000; 105(1):101–111. doi:10.1172/JCI7954 [CrossRef]
  3. Sun YX, Schneider A, Jung Y, et al. Skeletal localization and neutralization of the stromal cell-derived factor-1(CXCL12)/CXCR4 axis blocks prostate cancer metastasis and growth in osseous sites in vivo [published online ahead of print November 6, 2004]. J Bone Miner Res. 2005; 20(2):318–329. doi:10.1359/JBMR.041109 [CrossRef]
  4. Ma Q, Jones D, Borghesani PR, et al. Impaired B-lymphopoiesis, myelopoiesis, and derailed cerebellar neuron migration in CXCR4- and stromal cell-derived factor-1-deficient mice. Proc Natl Acad Sci USA. 1998; 95(16):9448–9453. doi:10.1073/pnas.95.16.9448 [CrossRef]
  5. Wynn RF, Hart CA, Corradi-Perini C, et al. A small proportion of mesenchymal stem cells strongly expresses functionally active CXCR4 receptor capable of promoting migration to bone marrow [published online ahead of print July 13, 2004]. Blood. 2004; 104(9):2643–2645. doi:10.1182/blood-2004-02-0526 [CrossRef]
  6. Kitaori T, Ito H, Schwarz EM, et al. stromal cell-derived factor-1/CXCR4 signaling is critical for the recruitment of mesenchymal stem cells to the fracture site during skeletal repair in a mouse model. Arthritis Rheum. 2009; 60(3):813–823. doi:10.1002/art.24330 [CrossRef]
  7. Abbott JD, Huang Y, Liu D, Hickey R, Krause DS, Giordano FJ. Stromal cell-derived factor-1alpha plays a critical role in stem cell recruitment to the heart after myocardial infarction but is not sufficient to induce homing in the absence of injury [published online ahead of print November 8, 2004]. Circulation. 2004; 110(21):3300–3305. doi:10.1161/01.CIR.0000147780.30124.CF [CrossRef]
  8. Ma J, Ge J, Zhang S, et al. Time course of myocardial stromal cell-derived factor-1 expression and beneficial effects of intravenously administered bone marrow stem cells in rats with experimental myocardial infarction [published online ahead of print March 10, 2005]. Basic Res Cardiol. 2005; 100(3):217–223. doi:10.1007/s00395-005-0521-z [CrossRef]
  9. Hiltunen A, Vuorio E, Aro HT. A standardized experimental fracture in the mouse tibia. J Orthop Res. 1993; 11(2):305–312. doi:10.1002/jor.1100110219 [CrossRef]
  10. Gerstenfeld LC, Cullinane DM, Barnes GL, Graves DT, Einhorn TA. Einhorn TA. Fracture healing as a post-natal developmental process: molecular, spatial, and temporal aspects of its regulation. J Cell Biochem. 2003; 88(5):873–884. doi:10.1002/jcb.10435 [CrossRef]
  11. Einhorn TA. The cell and molecular biology of fracture healing. Clin Orthop Relat Res. 1998; (355 Suppl):S7–S21. doi:10.1097/00003086-199810001-00003 [CrossRef]
  12. Schroeder TM, Jensen ED, Westendorf JJ. runt-related transcription factor 2 : a master organizer of gene transcription in developing and maturing osteoblasts. Birth Defects Res C Embryo Today. 2005; 75(3):213–225. doi:10.1002/bdrc.20043 [CrossRef]
  13. Khurana R, Simons M. Insights from angiogenesis trials using fibroblast growth factor for advanced arteriosclerotic disease. Trends Cardiovasc Med. 2003; 13(3):116–122. doi:10.1016/S1050-1738(02)00259-1 [CrossRef]
  14. Kalfas IH. Principles of bone healing. Neurosurg Focus. 2001; 10(4):E1. doi:10.3171/foc.2001.10.4.2 [CrossRef]
  15. Street J, Bao M, deGuzman L, et al. Vascular endothelial growth factor stimulates bone repair by promoting angiogenesis and bone turnover [published online ahead of print July 12, 2002]. Proc Natl Acad Sci USA. 2002; 99(15):9656–9661. doi:10.1073/pnas.152324099 [CrossRef]
  16. Tarkka T, Sipola A, Jamsa T, et al. Adenoviral vascular endothelial growth factor-A gene transfer induces angiogenesis and promotes bone formation in healing osseous tissues. J Gene Med. 2003; 5(7):560–566. doi:10.1002/jgm.392 [CrossRef]
  17. Chen D, Zhao M, Mundy GR. Bone morphogenetic proteins. Growth Factors. 2004; 22(4):233–241. doi:10.1080/08977190412331279890 [CrossRef]
  18. Lieberman JR, Friedlaender GE. Bone Regeneration and Repair: Biology and Clinical Applications. Totowa, New Jersey: Humana Press; 2005.
  19. Herzog EL, Chai L, Krause DS. Plasticity of marrow-derived stem cells. Blood. 2003; 102(10):3483–3493. doi:10.1182/blood-2003-05-1664 [CrossRef]

Brief Instructions About the Target Genes Analyzed by RT-PCR

NameRole
BMPKey factor in osteoblast differentiation
APMarker for active bone formation
BSPMarker for mineralized tissues
VEGFMarker for vasculogenesis and angiogenesis
FGFMarker for angiogenesis
Runx2Marker for osteoblast differentiation
Col IIMarker of chondrocytes
Col XMarker for hypertrophic chondrocytes

Primer Sequences Used for Polymerase Chain Reaction and Amplification

GenePrimer Nucleotide Sequence (5’-3’)Product Size, bp
18sForward: CGG CTA CCA CAT CCA AGG AAReverse :GCT GGA ATT ACC GCG GCT186
BMP-7Forward: TGG GTG GTC AAC CCT CGG CAReverse: ACA GGC CCG GAC CAC CAT GT582
APForward: GAA GAC GTG GCG GTC TTT GCReverse: GGG AAT CTG TGC AGT CTG TG457
BSPForward: GAGGCGGAGGCAGAGAACGCReverse: TTCCCGCCATCCACCTCCGT284
Collagen type XForward: TTC TGC TGC TAA TGT TCT TGA CCReverse: GGG ATG AAG TAT TGT GTC TTG GG115
VEGFForward: CCT GGT AAT GGC CCC TCC TCReverse: CCC CAT TGC TCT GTG CCT TG186
Collagen type II –α1Forward: GAGCGGTAGAGACCCGGACCCReverse: TTGGCCCTAATTTTCGGGCATCCTG187
Runx2Forward: CTT CGC CGT CCA TTC ACT CCReverse: GTG CAT TCG TGG GTT GGA GA181
FGF-1Forward: TCAGTGCGGAAAGTGCGGGCReverse: CCGCGCTTACAGCTCCCGTT223
Authors

Drs Li, Gao, and Wang are from the Department of Orthopedic Surgery, Jilin University/China-Japan Union Hospital, Jilin Province, China.

Drs Li, Gao, and Wang have no relevant financial relationships to disclose.

Correspondence should be addressed to: Xin Li, MD, 126 Xian Tai Ave, Department of Orthopedic Surgery, Jilin University/China-Japan Union Hospital, Changchun, Jilin Province, China, 130033 (doctorlixin@gmail.com).

10.3928/01477447-20110427-19

Sign up to receive

Journal E-contents